Ensembl

18/03/2026

Want to level up your fungal genomics skills? Join our hands-on virtual training in Fungal Pathogen Genomics, covering Ensembl Fungi and other top web-resources for the field. Apply today!

https://coursesandconferences.wellcomeconnectingscience.org/event/fungal-pathogen-genomics-virtual-20260601/

Applications close: 28 March 2026
Course runs: 1-5 June 2026

05/03/2026

Excited to build cutting-edge web tools for genomic research? Join us at Ensembl as a Web Developer. Apply here: https://www.ensembl.info/2026/03/04/job-rust-frontend-developer/

Closing date: 25th March 2026

Job: Rust Frontend Developer 4th March 2026 by Aleena Mushtaq·0 Comments EMBL-EBI and the Ensembl project are looking for a Web Developer to help develop and deliver our next generation resources (beta.ensembl.org). Location:EMBL-EBI, Hinxton near Cambridge, UK (Hybrid)Contract Duration:3 years (gr...

17/02/2026

Exciting opportunity to join our team!

Job: Genomics Technology Infrastructure Team Leader
Please follow the instructions in the ad to apply (https://www.ensembl.info/2026/02/17/job-genomics-technology-infrastructure-team-leader/).
Closing date: 25/03/2026

Job: Genomics Technology Infrastructure Team Leader 17th February 2026 by Aleena Mushtaq·0 Comments We are enthusiastic to announce a new EMBL Faculty role to head our ongoing developments whilst continuing to meet emerging demands of Ensembl as the Genomics Technology Infrastructure Team Leader at...

12/02/2026

We’re pleased to share that Ensembl release 116 and Ensembl Genomes release 63 are scheduled for April 2026.

Our declaration of intentions outlines planned updates and improvements. Read the full summary here:
https://www.ensembl.info/2026/02/12/whats-coming-in-ensembl-release-116-ensembl-genomes-63/

Important update:

In summer 2026, all new data will be available exclusively through the new Ensembl platform. The current ensembl.org site will redirect to the platform presently hosted at beta.ensembl.org. Previous Ensembl releases will continue to be accessible via Ensembl Archives https://www.ensembl.org/info/website/archives/index.html.

27/01/2026

Get to know the people behind Ensembl and meet Disha Lodha from the Ensembl Plants & Metazoa team in our latest blog post at https://www.ensembl.info/2026/01/27/getting-to-know-us-disha-lodha-ensembl-plants-metazoa/

26/01/2026

Exciting opportunity at Ensembl!
We’re hiring a Bioinformatics developer to contribute to the development of the Ensembl Variant Effect Predictor (VEP).
More info: https://www.ensembl.info/2026/01/22/job-bioinformatics-developer-13/

Job: Bioinformatics Developer 22nd January 2026 by Aleena Mushtaq·0 Comments We are seeking an experienced and highly motivated software developer to join the Ensembl team at EMBL-EBI and contribute to the development of the Ensembl Variant Effect Predictor (VEP). Location:EMBL-EBI, Hinxton near Ca...

14/01/2026

Exciting opportunity at Ensembl!
We’re hiring a Bioinformatician to help drive large-scale genomics and generate gene annotation for GENCODE or PARADIGM.
More info:

Job: Bioinformatician 5th January 2026 by Aleena Mushtaq·0 Comments We are looking for highly motivated candidates who possess scientific curiosity and initiative. You are a bioinformatics developer looking to apply your skills and knowledge to software development, large-scale computation, big dat...

09/01/2026

If you're in sunny San Diego for , join us at our workshop, “Integrated Genome Resources at EMBL-EBI”, to learn more about our exciting new features and data resources for genomics and pangenomics!

It's on Sunday 11 January from 8:00– 12:00, we hope to see you there!

08/01/2026

New genome annotation has been added to Ensembl Beta, including annotation for the nine-banded armadillo (Dasypus novemcinctus) and common buzzard (Buteo buteo)!
You can explore all available species here: https://beta.ensembl.org/species-selector

Image credits:
https://commons.wikimedia.org/wiki/File:Nine-banded_Armadillo_(Dasypus_novemcinctus)_(37649606094).jpg
https://commons.wikimedia.org/wiki/File:Buteo_buteo_-Scotland-8.jpg

25/12/2025

From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA"

And while you are decoding that, here is riddle number two: this photo was taken at the very last stop of our final Ensembl workshop of the year… can you guess where?

10/12/2025

Ensembl job alert: Bioinformatics Developer in Ensembl Compara
More information here: https://www.ensembl.info/2025/12/10/job-bioinformatics-developer-ensembl-compara/

We are seeking a highly motivated and experienced developer to help expand the Comparative Genomics resources in , a world-leading provider of genomics data, infrastructure, and tools.

Closing date: 12 January 2026

Job: Bioinformatics Developer Ensembl Compara 10th December 2025 by Aleena Mushtaq·0 Comments We are seeking a highly motivated and experienced bioinformatics developer to help expand the Comparative Genomics resources in Ensembl, a world-leading provider of genomics data, infrastructure, and tools...

05/12/2025

🌟 Exciting Outreach at Uni Valle Cali🌟

In November, Aleena M Stolworthy from Ensembl Outreach visited Universidad del Valle in Cali, Colombia during their Open Day to introduce 100 students from three public schools in Valle del Cauca region to the world of bioinformatics. This project was led by Diego Fernando Echeverri Garcia and his team.

We discussed the exciting research happening at European Bioinformatics Institute | EMBL-EBI-EBI and highlighted the importance of open-access resources available at EMBL-EBI Training